454 Lemonade

new assembly algorithm for 454

2009-07-31T11:39:00.001-07:00

A nice new paper in Computational Biology and Computing "Whole genome assembly from 454 sequencing output via modified DNA graph concept" by Blazewicz et al.

Neandertal population genetics

2009-07-17T07:20:00.001-07:00

A new paper in this weeks Science "Targeted Retrieval and Analysis of Five Neandertal mtDNA Genomes" by Paabo's group. Details a method for pulling out rare sequences from a mixture via a primer extension method. Pretty neat!

new review by Hamady and Knight

2009-07-10T11:16:00.000-07:00

A very nice new paper by Hamady and Knight in Genome Research "Microbial community profiling for human microbiome project: Tools, techniques, and challenges".

new review paper

2009-06-16T11:02:00.000-07:00

I wrote a review on metagenomics and high-throughput sequencing for Estuaries and Coasts. It highlights a series of pitfalls that I've seen over the last two years doing Roche/454 runs. You can find a preprint here.

STOP! Important notice inside

2009-06-15T09:56:00.001-07:00

I never like seeing stickers like this on Roche/454 reagents. Turns out there is a new "additive" to the emPCR for Titanium. More can be read here.

swine flu was around in 2008

2009-06-12T10:40:00.001-07:00

An advance paper in Nature on the origin and TMRCA of the 2009 swine flu.

bTEFAP vs Sogin et al barcodes?

2009-06-05T10:11:00.001-07:00

Has anyone every tried the bTEFAP protocol for barcoding amplicons for FLX runs? If so, please let me know... All amplicons we've done to date have been similar to Sogin's protocol for barcoding.

Bee parasite genome released

2009-06-05T07:06:00.000-07:00

A new paper on a parasite implicated in Colony Collapse Disorder in bees. Here is the press release.

Closing gaps in the human genome with 454

2009-06-02T08:26:00.000-07:00

You never finish a genome.... Here is a group from MIT/Broad with a new paper in Genome Biology on closing gaps (class IIIs) in the human genome with 454.

Gene expression using 454 data

2009-06-01T12:52:00.000-07:00

THe first paper on using 454 data for gene expression studies.

Science Friday rocks!

2009-05-29T12:01:00.001-07:00

I caught part of todays Science Friday on NPR and they were talking with Julie Segre about the work going on with the human microbiome (also reference to their recent paper in Science).
Who says scientists aren't famous? Rock on Julie!

Assessing biodiversity in nematodes

2009-05-20T10:17:00.000-07:00

An interesting paper coming out in Mol Ecol Res: "Evaluating high-throughput sequencing as a method for metagenomic analysis of nematode diversity".

Normalization and rarefaction in gene discovery.

2009-05-19T12:50:00.000-07:00

A new paper, "Next-generation pyrosequencing of gonad transcriptomes in the polyploid lake sturgeon (Acipenser fulvescens): the relative merits of normalization and rarefaction in gene discovery" in BMC Genomics.

Jonathan Eisen's blog

2009-05-19T10:09:00.000-07:00

It's always fun to see what he's up to.

FLX/Ti test fragments

2009-05-15T12:42:00.000-07:00

Some people have asked for information on the test fragment sequences. If you look in the dataRunParams.xml, the sequences for all 6 TFs are listed for FLX and the 6 AVTFs are listed for Titanium.

Flow cytometry for enrichment/titration

2009-05-15T08:06:00.000-07:00

A nice new method paper "Flow cytometry for enrichment and titration in massively parallel DNA sequencing" in NAR.

Titanium (Ti) cDNA protocol

2009-05-14T09:26:00.000-07:00

A huge thank you to Misha Matz and his lab who have recently released a protocol using suppression PCR to create cDNA for Titanium (Ti) Roche/454 Life Sciences pyrosequencing.
They have a new paper in BMC Genomics detailing the use of this protocol for FLX.

effect of PCR amplicon size on microbial diversity

2009-05-12T13:59:00.000-07:00

A nice new paper out by Julie Huber out in Environmental Microbiology: "Effect of PCR amplicon size on assessments of clone library microbial diversity and community structure."

Metastats paper

2009-05-01T08:35:00.000-07:00

A nice new paper came out recently allowing a more statistical analysis of metagenome samples. They have their software available at http://metastats.cbcb.umd.edu

@454Sequencing

2009-05-01T07:54:00.000-07:00

I don't use twitter, but you may be interested in following 454

454 transcript sequences are now searchable through BLAST

2009-05-01T07:43:00.000-07:00

A new option through BLAST specifically for 454.

Pyrosequencing pipeline at RDP

2009-05-01T07:41:00.000-07:00

An awesome tool at the RDP for pyrosequencing. Many thanks to my friends at harvards for letting me know about this.

Press releases of interest

2009-02-27T08:00:00.000-08:00

I was just too busy this week to post the 5 articles on Wednesday but I did find some good links of general interest:
-Mouth Microbiomes Diverse the World Over
-Roche NimbleGen Microarrays Selected as Technology of Choice for the Neuromuscular Disorder -Chip Consortium
-Molecular Diversity of a North Carolina Wastewater Treatment Plant As Revealed by Pyrosequencing

Another 454 discussion site

2009-02-26T09:11:00.000-08:00

I stumbled across this other site which is a forum for 454 troubleshooting.

delays in posting: Ti runAnalysisPipe issues

2009-02-26T08:13:00.000-08:00

Well, I've been up to my ears in getting the runAnalysisPipe to do the signal processing on our most recent Ti run. The good news is we got ~1.5 million reads but the bad news is all of that data is tied up in the CWF format....
For those interested, here is the verbose output. it seems to be kicking out of the program with no error. Roche has assigned a GC number to it so hope to post that soon.
----gsRunProcessorlog-------
[Wed Feb 25 09:02:21 2009][Debug][] Logging configured.
[Wed Feb 25 09:02:21 2009][Information][] gsRunProcessor 2.0.00.22 (Build 184) Starting
[Wed Feb 25 09:02:21 2009][Debug][] Parsing pipeline: /etc/gsRunProcessor/signalProcessing.xml
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step NukeSignalStrengthBalancer (pass 1)
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step BlowByCorrector
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step CafieCorrector
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step NukeSignalStrengthBalancer (pass 2)
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step IndividualWellScaler
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step MostLikelyErrorSubtractor
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step WellScreener (pass 1)
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step MetricsGenerator
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step QualityFilter
[Wed Feb 25 09:02:21 2009][Debug][ProcessingEngine] Adding step BaseCaller
[Wed Feb 25 09:02:29 2009][Information][] Detected processor speed: 2129 MHz.
[Wed Feb 25 09:02:39 2009][Notice][ProcessingEngine] Starting job eb6dd82e-0344-11de-ad6c-0010182f8ff4.
[Wed Feb 25 09:02:39 2009][Debug][ProcessingEngine] Creating 1 processing group(s).
[Wed Feb 25 09:02:39 2009][Information][ProcessingEngine] Using memory-only storage for flowgrams.
[Wed Feb 25 09:02:39 2009][Notice][ProcessingEngine] Processing Group 0 : Loading data.
[Wed Feb 25 09:02:39 2009][Information][ProcessingEngine] Opening file /home/kc/Desktop/D_2009_02_20_12_47_04_FLX02070135_imageProcessingOnly/regions/2.cwf
[Wed Feb 25 09:02:39 2009][Debug][ProcessingEngine] Region 2 : Process 0 is loading 2049,1 4095,4095

Roche adapters/primers for FLX chemistry

2009-02-19T06:17:00.001-08:00

These are available publicly in a variety of places, but I'll post all of them here for the community:
emPCR Kit I
MMP3A emPCR primer CCA TCT CAT CCC TGC GTG TC
MMP3B emPCR primer CCT ATC CCC TGT GTG CCT TG
UA3A(TCAG) Library Prep Adapter C*C*A*T*CT CAT CCC TGC GTG TCC CAT CTG TTC CCT CCC TGT C*T*C* A*G
UA3B(TCAG) Library Prep Adapter /5Bio/C*C*T*A*TC CCC TGT GTG CCT TGC CTA TCC CCT GTT GCG TGT C*T*C* A*G
MMP7A Sequencing Primer CCATCTGTTCCCTCCCTGTC

emPCR Kit II and III
Primer A (TCAG) Template amplification GCC TCC CTC GCG CCA TCAG
Primer A emPCR/Sequencing primer (KitA) GCC TCC CTC GCG CCA
Primer B (TCAG) Template amplification GCC TTG CCA GCC CGC TCAG
Primer B emPCR/Sequencing primer (KitB) GCC TTG CCA GCC CGC

New 454 papers: Feb 18, 2009

2009-02-18T08:04:00.000-08:00

This weeks selections:
1) A comprehensive survey of soil acidobacterial diversity using pyrosequencing and clone library analyses.
2) Metagenomic and stable isotopic analyses of modern freshwater microbialites in Cuatro Ciénegas, Mexico
3) A 454 Sequencing Study Reveals New Insights in Drug Resistance and Tropism Associated with the New HIV Integrase and Entry Inhibitor Therapy Classes
4) Simple, sensitive, and swift sequencing of complete Avian Influenza H5N1 genomes.
5) Assessing the feasibility of GS FLX Pyrosequencing for sequencing the Atlantic salmon genome

$10B for NIH, thank your senators

2009-02-17T13:14:00.000-08:00

It's official: NIH has $10B. Now I'm going to call and thank Senators Durbin (202-224-2152) and Specter (202-224-4254) to thank them for supporting basic biomedical research.

Invitrogen SequalPrep Normalization plates

2009-02-16T13:35:00.000-08:00

Invitrogen has released (May 2008 I think is when they were publicly available) a nifty new trick for those wanting to purify and standardize PCR amplicons for high-throughput sequencing. It is called Invitrogen SequalPrep and ends us being $1/sample compared to the laborious method of Ampure (from Agencourt). We've done a few amplicon LR70s where different labs have used the Invitrogen plates and they seem happy. I'd be curious to hear what amount of variation in sequencing coverage is seen.

cDNA with Titanium

2009-02-13T08:24:00.000-08:00

When I went to the Titanium chemistry release party back in September 2008, I had the opportunity to chat with a bunch of other 454 faciity directors. One comment that I heard several times was that no one really ran cDNA (mostly due to the adapter issue, see previous post on cDNA preparation). I feel pretty comfortable with sequencing cDNA (mostly Evrogen and Bio S&T normalized) with the FLX though it does give lower amounts of data (usually 60-80 Mb). Now with Titanium, I'm hearing from the Roche/454 people that cDNA is not "ideal". Does anyone have any experience with cDNA on Titanium? We've done a few and the results have been disappointing (low filter pass, only ~20% of anticipated data, etc).

Hacking your FLX

2009-02-12T13:40:00.000-08:00

I love Bruce Roe's website, especially this page for squeezing all of the bases out of a normal FLX run.

Automated emulsion breaking?

2009-02-12T13:11:00.000-08:00

I know that Broad has an automated system for breaking emulsion PCRs and JGI is working on one as well. Bruce Roe's group has a centrifuge-based one that we've tried but it ends up being more time-consuming than the syringes.
Any others? There must be a better way than syringes...

Neandertal genome draft completed

2009-02-12T07:48:00.000-08:00

MPI has released a press release of the announcement.

Happy Birthday Darwin!

2009-02-12T06:30:00.000-08:00

Please take a minute and think about how Darwin has impacted your life and research.

New 454 papers: Feb 11, 2009

2009-02-11T12:23:00.000-08:00

Every Wednesday, I'm going to post 5 new papers (within the last year) on this blog.
Here we go:
1) Population Genetic Inference From Resequencing Data; I'm a pop gen person at heart so I'm glad to see this paper using 454/Illumina for getting at p and q.
2) Exploring Microbial Diversity and Taxonomy Using SSU rRNA Hypervariable Tag Sequencing
3) The Pervasive Effects of an Antibiotic on the Human Gut Microbiota, as Revealed by Deep 16S rRNA Sequencing: this is my pick this week. Awesome paper.
4) Applications of next-generation sequencing technologies in functional genomics
5) The metagenomics RAST server – a public resource for the automatic phylogenetic and functional analysis of metagenomes

Thanks for the positive feedback!

2009-02-11T11:52:00.000-08:00

Thanks to everyone who has been so supportive of the creation of this blog. I'm glad to hear this is a useful resource. Please feel free to pass along to others as well as send me ideas/comments/etc.
When life give you lemons, you make lemonade- that's the purpose of this blog.

Options for shearing DNA

2009-02-11T11:49:00.000-08:00

I've heard rumor that the Covaris system is better than the HydroShear for shearing DNA. Any real data people can share to back this up?

Whole genome amplification protocols

2009-02-11T09:23:00.000-08:00

Probably the second most asked question that I get is with regards to quantity needed for 454 pyrosequencing. I always feel like the brat visiting Santa asking for too much. Truth be told, 3-5 ug is what the Roche protocol calls for. My inside source says 1 ug is the absolute minimum. The problem isn't that you need that much material for the single-stranded library. It's how you get to the library. Namely, using Qiagen columns which lose ~50% of the sample for each of the 3 purifications.
What do you do to make more sample from what may be all you will ever get? There are two main options: 1) whole genome amplification and 2) PCR amplification using the sequences of the Roche adapters. The first option can be achieved through commerically available kits such as Genomiphi from GE Healthcare or Qiagen's equivalent.
The second option has been formalized in a recent paper by Blow et al in Genome Research. We have used the Blow et al protocol for amplifying bacterial genomes, euk cDNA, bacterial cDNA, and metagenomes without any discernable bias (also noted by Blow et al). We have done some pilot projects with the Genomiphi and the jury is still out. We get lots of product but see a higher level of shortQuality reads on our test 454 runs. We have performed several runs where the PI prepared the Genomiphi sample and they look just as good as a normal library (i.e., ~100 Mb on a FLX run).

cDNA for pyrosequencing

2009-02-10T06:49:00.000-08:00

The question that I get most is how to prepare cDNA for pyrosequencing. Pyrosequencing of complementary DNA (cDNA) poses a unique set of drawbacks, but is ultimately related to the issues of pyrosequencing homopolymers. Eukaryotic cDNA is transcribed from messenger RNA (mRNA) typically using commercially available kits that use a Poly-T primer (i.e., Invitrogen SuperScript). Because eukaryotic mRNA is poly-adenylated on the 3’ end, the poly-T primer is used to target this region, as T is the complement of A for pairing. The one drawback of pyrosequencing cDNA libraries is the presence of long regions of homopolymers. In our experience, the accuracy of Roche/454 Life Sciences base calling on homopolymers diminishes markedly after the 5th or 6th base in a homopolymer stretch. If by the third flow no nucleotides are incorporated, that particular read is discarded. This problem of data loss by the A homopolymers is exasperated by the fact that the intensity of the bead with the 30+ As is also obscuring neighboring beads, thus causing additional loss of data. Finally, the faulty reads obscure the control reads such that even the data collected cannot be used with much confidence. Fortunately, a recent, simple modification solves the polyA dilemma with Roche/454 Life Sciences pyrosequencing.
Since the confounding issue is the presence of the polyA tail on the 3’ end of the cDNA, Novaes et al (2008) have incorporated a modified 3’ primer that has a rare restriction site (SfiI) built in the 3’ cDNA adapter primer. Following relatively standard cDNA protocols, the additional step of digesting the cDNA with SfiI and removal of the polyA tail via column or Ampure purification greatly increases the percent passing reads and data yield. A similar solution has been proposed by Frias-Lopez et al (2008) for bacterial cDNA. Bacterial cDNA (which lack adenylation on their mRNA) are polyadenylated via ligation, thus making them effectively eukaryotic cDNA for downstream applications. A rare restriction enzyme (BpmI) recognition sequence is inserted between the polyT and the T7 promoter sequence thus allowing removal of the confounding polyA region prior to pyrosequencing library construction.

Barcoding for the masses

2009-02-10T06:43:00.001-08:00

Many people want to use the barcoding option (=MIDs) for pyrosequencing but either 1) want to sequence more than 12 different samples at one time (the current number available from Roche), 2) want to use Titanium (which currently does not have available the emulsion kits for the barcoding), or 3) want to do it themselves. A protocol from Matthias Meyer and colleagues provides the details for those interested in doing their own barcoding in their extremely detailed paper "Parallel tagged sequencing on the 454 platform" in Nature Protocols (http://www.nature.com/nprot/journal/v3/n2/abs/nprot.2007.520.html). The software is extremely straightforward to use as well.

Welcome to the unofficial Roche/454 Life Sciences support blog!

2009-02-10T06:22:00.000-08:00

Welcome to the unofficial Roche/454 Life Sciences support blog. I've started this blog to encourage sharing of information among researchers using the Roche/454 Life Sciences Genome Sequencer platform. I've been running a genomics facility at the University of South Carolina sine October 2007. Over the past year and a half, we've learned a lot of hard lessons with regards to optimizing the FLX chemistry. Now, we're in the midst of optimizing the Titanium chemistry. I'm going to post our discoveries, questions, protocols, new papers, and pontifications on this site for all to see and hopefully establish some dialogue to help us all out. If you have any specific questions that you would like see addressed, please drop me a line at 454lemonade@gmail.com.
Again, welcome! -Joe